Getting the reverse complementΒΆ

Section author: Gavin Huttley

This is a property of DNA, and hence alignments need to be created with the appropriate MolType. In the following example, the alignment is truncated to just 50 bases for the sake of simplifying the presentation.

>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs("data/long_testseqs.fasta", moltype=DNA)[:50]

The original alignment looks like this.

>>> print aln
>Human
TGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTT
>HowlerMon
TGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTT
>Mouse
TGTGGCACAGATGCTCATGCCAGCTCATTACAGCCTGAGACCAGCAGTTT
>NineBande
TGTGGCACAAATACTCATGCCAACTTATTACAGCATGAGAACAGCAGTTT
>DogFaced
TGTGGCACAAATACTCATGCCAACTCATTACAGCATGAGAACAGCAGTTT

We do reverse complement very simply.

>>> naln = aln.rc()

The reverse complemented alignment looks like this.

>>> print naln
>Human
AAACTGCTGTTCTCATGCTGTAATGAGCTGGCATGAGTATTTGTGCCACA
>HowlerMon
AAACTGCTGTTCTCATGCTGTAATGAGCTGGCATGAGTATTTGTGCCACA
>Mouse
AAACTGCTGGTCTCAGGCTGTAATGAGCTGGCATGAGCATCTGTGCCACA
>NineBande
AAACTGCTGTTCTCATGCTGTAATAAGTTGGCATGAGTATTTGTGCCACA
>DogFaced
AAACTGCTGTTCTCATGCTGTAATGAGTTGGCATGAGTATTTGTGCCACA